lncRNA Structure Prediction

I. Result for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of (-113.00) is given below.

1. Sequence-
CAGAACCGCAUGGUCUUCUCUAGUUUACAAAAGUCCUCCACUUGUUCCUUCACCUCUCUA
UCUUCGUAACAGCACACAAAUUGAAAGAAAGACGCUUGGUUUCUUCGCGUGUUACAAACG
UCUUUUACUCAAACUUUUCUCCUCAUCUUGUCUCUUUCUUACAUUACGCCAAACUCCCCG
CCGAUUUGUUUCUCUCUUUUUUUUAAUCUGUUUUGCUUUUUGGUUUUGCAGAGCACGUCA
UUUUCUAUUAAGAAAAAAAGGAACAAGAAACCAGCAAAUUUUUGUAGACUCACAGUUCCU
UUGUUUGUGUUUGCUUUGUGGGUCGGUUUUAUUUUCAUUUGAAUUUCAAGACAAGUCUCU
UGUUUCUCUUGGGUUUGUGUUUUCUUUAAGUUUAAUUGAAGAAAAAUUGUAACUUCGGGG
UUAUGGGUUUUGACUUUAACAGAGAAAAUUACGCCGGAAUUAUUGGUUCACGGUGACCAG
GGAAAAAAAUUUGGAAAAAGAAAGAAACUUUUAAGAUUUUCAAUACUUACUGUUCCCUUU
UUUGUUGUCCAAACGUCAAAAAAUAGUUUUCAUGUUUAAAUAUUUUUUUUUUUU

2. MFE structure-
(((((((.((((.........(((((((((((((.((...((((((((((.........................((((((((.((((((((.((..(((......((((.......)))).......................)))..)).)))))))).......((..........))))))))))...........
........((((((((...........)))))))).....((((((....)))))).)))))))))).....))...)))))))))))))(((((.........)))))...((((((.((..(((((((.((((((.((((((((.((((((((.(((...........))))))).....)))).)))))))).))))
)))))))))...)).))))))))))))))))).....((((..((((((((((((((((((...))))).)))))...((((((......(((((((..(((((...)))))....))))))).........))))))((((((.(((....))).)))))).)))))))).))))..................

You can download the minimum free energy (MFE) structure in Vienna Format

II. Results for thermodynamic ensemble prediction

1. The free energy of the thermodynamic ensemble is [-124.85] kcal/mol.

2. The frequency of mfe structure in ensemble 4.48302e-09.

3. The ensemble diversity 134.35.

4. You may look at the dot plot containing the base pair probabilities [below]

Download Dot plot JPG EPS

III. Graphical output

1. A note on base-pairing probabilities:--

The structure below is colored by base-pairing probabilities. For unpaired regions the color denotes the probability of being unpaired. The reliability information of RNA secondary structure plot in the form of color annotation, Positional entropy ranging from red (low entropy, well-defined) via green to blue and violet (high entropy, ill-defined).

Download RNA structure JPG EPS

2. Here you find a mountain plot representation of the MFE structure, the thermodynamic ensemble of RNA structures, and the centroid structure. Additionally we present the positional entropy for each position. The resulting plot shows three curves, two mountain plots derived from the MFE structure (red) and the pairing probabilities (black) and a positional entropy curve (green). Well-defined regions are identified by low entropy.

Download mountain plot JPG EPS